|
 
 |
| ORIGINAL ARTICLE |
|
| Year : 2020 | Volume
: 6
| Issue : 1 | Page : 38-42 |
|
Comparative evaluation of conventional method versus polymerase chain reaction for detection of methicillin resistant staphylococcus aureus isolated from blood stream infections
Shreyashi Tuladhar1, Narayan Raj Bhattarai2, Ratna Baral2, Keshav Rai3, Basudha Khanal4
1 Lecturer, Dept. of Microbiology, Patan Academy of Health Sciences, Lagankhel, Kathmandu, Nepal, India
2 Additional Professor, Dept. of Microbiology and Infectious Diseases, B.P. Koirala Institute of Health Sciences, Ghopa, Dharan, Nepal, India
3 Senior Demonstrator, Dept. of Microbiology and Infectious Diseases, B.P. Koirala Institute of Health Sciences, Ghopa, Dharan, Nepal, India
4 Professor and Head, Dept. of Microbiology and Infectious Diseases, B.P. Koirala Institute of Health Sciences, Ghopa, Dharan, Nepal, India
| Date of Submission | 04-Sep-2019 |
| Date of Acceptance | 13-Jan-2020 |
| Date of Web Publication | 12-Feb-2020 |
Correspondence Address:
Shreyashi Tuladhar
Lecturer, Dept. of Microbiology, Patan Academy of Health Sciences, Lagankhel, Kathmandu, Nepal
India
 Source of Support: None, Conflict of Interest: None
Background: Clinically significant bloodstream infection (BSI)due to Staphylococcus aureus(S.aureus)isa significant pathogen in community acquired and nosocomial BSI. Methicillin Resistant Staphylococcus aureus (MRSA) are resistant to methicillin and all χ-lactam antibiotics due to possession of mec A gene. Several phenotypic methods for laboratory detection of MRSA: oxacillin screening test, oxacillin or cefoxitin disc diffusion method, oxacillin minimum inhibitory concentration test are used routinely in our setting.
Aim: We aim to detect MRSA among blood culture isolates by conventional method (cefoxitin disc) and also to confirm identity of these MRSA strains by molecular method i.e. mecA detection by Polymerase Chain Reaction(PCR).
Materials and Methods: This cross sectional study was carried out on 139 S. aureus clinical isolates in Department of Microbiology from blood samples submitted for culture and sensitivity test. Once the isolate was identified as S. aureus, it was further identified as MRSA or Methicillin Sensitive Staphylococcus aureus (MSSA) by use of antimicrobial discs. DNA extraction was done by boiling method.
Results: Antimicrobial susceptibility pattern documented resistance of 48.9% of isolates to cefoxitin (MRSA). 80.2% and 63.3% of isolates were resistant to penicillin and cotrimoxazole respectively. All isolates were susceptible to vancomycin. Conventional PCR was carried out for all 139 samples. 51.1% of isolates harbored mecA gene thus identified as MRSA.
Conclusion: As expected PCR performed superior, however due to less cost, simplicity and easy availability, cefoxitin disc diffusion test holds a significance as an alternative to PCR for detection of MRSA on routine basis in a resource limited setting like ours.
Keywords: BloodStream Infections, MRSA, PCR
How to cite this article:
Tuladhar S, Bhattarai NR, Baral R, Rai K, Khanal B. Comparative evaluation of conventional method versus polymerase chain reaction for detection of methicillin resistant staphylococcus aureus isolated from blood stream infections. J Indira Gandhi Inst Med Sci 2020;6:38-42 |
How to cite this URL:
Tuladhar S, Bhattarai NR, Baral R, Rai K, Khanal B. Comparative evaluation of conventional method versus polymerase chain reaction for detection of methicillin resistant staphylococcus aureus isolated from blood stream infections. J Indira Gandhi Inst Med Sci [serial online] 2020 [cited 2023 Mar 24];6:38-42. Available from: http://www.jigims.co.in/text.asp?2020/6/1/38/300737 |
| Introduction | |  |
MRSA are resistant to all χ-lactam antibiotics but are susceptible to newest class of MRSA active cephalosporin and have emerged globally as a significant nosocomial pathogen, and its prevalence in the community is now escalating substantially.[1] Several methods for laboratory detection of MRSA like oxacillin screening test, oxacillin and/or cefoxitin disc diffusion method and oxacillin minimum inhibitory concentration test are used in routine practice in our setting. Conventional methods are associated with false results so in many instance it has been felt necessary to use more exact and specific methods such as genomic methods for detection of MRSA. MRSA is known to harbor mecA gene responsible for resistance to methicillin and χ- lactam antibiotics.[2] PCR(Polymerase Chain Reaction) based assays are considered as the gold standard for the detection of MRSA due to the heterogeneous resistance by various phenotypic detection methods displayed by many clinical isolates. Genotypic methods are more precise in detecting methicillin resistant Staphylococci as compared to conventional susceptibility method.[3] The proposed study therefore aimed to detect MRSA among the blood culture isolates by routine conventional method (cefoxitin disc) and confirm their identity by using molecular method (mecA detection by PCR).
| Methodology | | |
The study was carried out in the Department of Microbiology, BP Koirala Institute of Health Sciences (BPKIHS), Dharan, Nepal from September 2015 to July 2016. Ethical clearance was obtained from the Institutional Review Committee (IRC/568/015) at BPKIHS.
Isolation - Blood samples submitted for the purpose of culture and sensitivity test to the department of microbiology already inoculated into Brain Heart Infusion (BHI) broth at the time of receive were evaluated. After 24 and 48 hours of aerobic incubation at 37°C, subcultures were done on blood agar and Mac Conkey agar. Growth was recorded the next day. Bacterial growth if present was processed for further identification and antimicrobial susceptibility testing (AST).[4]
Identification - Smooth, densely opaque suspected colonies with or without hemolysis on the blood agar plate were processed further. Identification of S. aureus was done on the basis of colony morphology, gram stain, catalase test and coagulase test. ATCC S. aureus 25923 was put up as positive control.[4]
Antimicrobial Susceptibility Test. AST was performed on Mueller Hinton agar (MHA) plates by standard disk diffusion method as per Clinical Laboratory Standard Institute (CLSI) guidelines. S. aureus ATCC 25923 was used as control strain and tested along with test strains4.Antimicrobial disks supplied by Hi Media laboratories, India, were used. The size of zone of inhibition was interpreted according to CLSI guidelines and the organism was reported as susceptible, intermediate or resistant to the agents tested. MIC of Vancomycin was determined by agar dilution technique.[4]
Cefoxitin disc diffusion method - A colony of S. aureus isolate was prepared to a 0.5 McFarland standard and plated on MHA. A cefoxitin disk of 30 μg was placed on the surface and incubated at 37°C aerobically overnight. Zone diameter was read and v21 mm was considered resistant i.e. Methicillin Resistant Staphylococcus aureus (MRSA) whereas zone of inhibition v22 mm was considered sensitive i.e. Methicillin Sensitive Staphylococcus aureus (MSSA). ATCC 25923 S. aureus (mecA negative) and ATCC 43300 S. aureus (mecA positive) was used as control.4
PCR :
PCR based amplification was done for detection of mecA gene - DNA was extracted from all the isolates by boiling method 5 and 2μl of the isolated DNA was subjected to PCR with specific primers: Forward primer (MR3)AAAATCGATGGTAAAGGTTGGC and Reverse primer(MR4) AGTTCTGCAGTACCGGATTTTGC.6 PCR water 2μl was used as Negative Control (NC). The Positive Control (PC) SA11were used which were previously confirmed positive samples as obtained from other similar experiments done in BPKIHS molecular lab.
| Electrophoresis | | |
The PCR products were analyzed by electrophoresis in 2% agarose gel to detect specific amplified product by comparing with standard molecular weight marker of 100 base pair.6 The amplified products were visualized by trans-illuminator, photographed in the presence of UV light inside the G box (Gel doc) and read on the computer screen.
| Statistical Study | | |
The data were entered into Microsoft Excel 2013 and analyzed by using SPSS version 16 (SPSS Inc., Chicago, IL, USA). Kappa agreement tool was applied for the measurement of agreement.
| Results | | |
The purpose of the study was to determine the antimicrobial susceptibility pattern of S. aureus isolated from blood culture specimen to the generally used antimicrobials at BPKIHS hospital; to determine MRSA by cefoxitin disc and detect the presence of mecA gene among MRSA isolates and to determine the agreement between phenotypic and genotypic method for detection of MRSA. The total number of samples taken into study was one hundred and thirty nine S. aureus isolated from blood culture samples. | Figure 1: mecA gene detection by PCR among total S. aureus isolates (n=139)
Click here to view |
 | Figure 2: Resistance pattern of antibiotics by disc diffusion method among total S. aureus isolates (n=139)
Click here to view |
 | Table 1: Correlation between Cefoxitin disc diffusion method and mecA PCR results
Click here to view |
Positive Predictive Value(PPV)= TPx100/TP+FP=79.4%=TN Negative Predictive
Value(NPV)=TNx100/TN+FN+76.1%=TP Sensitivity=TP=76.1% Specificity= TN+ 79.4%
Interpretation of Kappa agreement: Kappa agreement was found to be moderate in strength.[7]
(Above mentioned figures are illustrated after the references as instructed)
| Discussion | | |
Although a part of normal flora in human, BSI due to S. aureus, has its annual occurrence of approximately 200,000 cases with mortality rates ranging from 20% to 50% worldwide.[8],[9],[10],[11]
| Antimicrobial Resistance | | |
Antimicrobial resistance among MRSA makes it a noteworthy pathogen in health care setting. Despite the term MRSA, methicillin is no longer used to detect this type of resistance. Oxacillin disc is reported to be less labile than methicillin on storage but is less resistant to hydrolysis by Staphylococcal χ-lactamases so problems with hyper producers of penicillinases are reduced with methicillin. Methicillin is no longer commercially available and oxacillin is more likely to detect heteroresistant strains. Cefoxitin is an even better inducer of the mecA gene, and tests using cefoxitin are known to give more reproducible and precise results than tests with oxacillin.[12]
Here, the antimicrobial susceptibility was tested against different antimicrobials as per the CLSI guidelines.4 Methicillin resistance by cefoxitin disc diffusion method was observed in 48.9% of the isolates. Similar results were obtained by studies carried out in Kathmandu Nepal (44.9%), in various parts of South India (40% - 45.45%) and Iran (46% to 48%).[13],[3],[1],[14] Much higher prevalence of MRSA was reported from studies in Pune (64%), Turkey (60.2%), Skopje(50.8%), Iran(50%).[15],[16],[17],[18]
Various studies done in different parts of India and Nepal reported lesser prevalence of MRSA.[19],[20],[21],[22] Discrepancy between the present study and those being compared may be due to overall lower prevalence of MRSA during that point of time.
Our study shows high rate of resistance to beta lactams, macrolides, aminoglycosides, quinolones, and tetracycline as compared to MSSA.
Usage of penicillin which was formerly the antimicrobial of choice for staphylococcal infections decreased gradually due to resistance developed and bizarre allergic reactions that occurred in patients. Most studies documented increasing tendency in resistance pattern to penicillin due to destruction of ε lactam ring by χ lactamase produced by S. aureus. In this study, penicillin showed the highest rate of resistance of 80.2%. Contrast to our study, 100% resistance has been reported in various parts of Nepal[13],[26] and much less resistance rate has also been reported (52.66%).[22] In due course of time indiscriminate use may be attributed to resistance development among the local isolates at varying frequency in various places.
The most effective treatment of MRSA infections are glycopeptides. All MRSA and MSSA isolates were sensitive to vancomycin. Similar result has been reported by many studies.[23],[26],[27],[28],[29] Threat of vancomycin resistance emergence is inevitable. Susceptibility test for vancomycin is confirmed by MIC as per CLSI guidelines. MIC range within 2μg/ml is termed as vancomycin sensitive and here 49.6% had MIC of 2μg/ml.30
Increasing use of vancomycin has led to selective pressure and subsequent appearance of VISA followed by VRSA has startled physicians and microbiologists.
Multidrug resistance among staphylococcal isolates has been recognized as one of the major challenges in controlling hospital infections. MRSA are known to possess resistance to many antimicrobials as compared to MSSA.
Multidrug resistance was infrequent and low in MSSA as compared to MRSA. In this study none of the MRSA isolates was found to be susceptible to all the antibiotic agents tested. 38% of the isolates were resistant to ?3 antibiotics. In contrast much higher rate of MDR MRSA, 89.2% was reported in Tamil Nadu.[31]
PCR :
Current gold standard method for MRSA detection is identification of mecA gene. The majority of MRSA harbours mecA gene which is a complex gene and it contains insertion sites for plasmids and transposons that facilitate acquisition of resistance to other antibiotics and prevalence of strains resistant to specific antibiotic maybe associated to the extent at which the antibiotic is used.[33]
Among the total 139 S. aureus isolates in our study, mecA gene was detected in 51.1%. It is essential to differentiate isolates that have mecA positive resistance from infrequently encountered isolates that have borderline resistance because it may affect therapy. Strains that possess mecA classic resistance are either heterogenous or homogenous in their expression of resistance. It is the testing of hetero resistant isolates which may appear as susceptible and also MRSA strains have 20 chromosomal genes engaged among which the best recognized ones are femA to femF and femX.[33] Gene instability and primer design could be anticipated as one of the reasons for discrepancy of results obtained.
| Conclusion | | |
Prevalence of MRSA in our setup is a great matter of concern. Although cefoxitin disc diffusion method and PCR documents almost same range of MRSA with moderate degree of agreement between them, molecular methods should be utilized to avoid the false negative results of routine testing and to track the trends of MRSA that are prevalent locally. Our results also insist a strict implementation and adherence to infection prevention and control practices.
| Acknowledgements | | |
All members of the Department of Microbiology and Molecular Biology laboratory, BPKIHS
| Funding | | |
None
| Availability of Data and Materials | | |
Yes, available. This is a hospital-based study. Samples were collected during the routine diagnostic procedure, and the. Therefore, the data of the analysis are available upon the request from the corresponding author or head, department of Microbiology ([email protected] bpkihs.edu), BP Koirala Institute of Health Sciences, Dharan, Nepal.
| Ethics Approval | | |
Was obtained from Institutional Ethical Review Board (IERB)
- Code no. Institutional Review Committee (IRC/568/015)
- Consent to participate: not applicable
Consent for publication
Not applicable
Competing interests
The authors declare that they have no competing interests.
| References | | |
| 1. | Pillai, M.M., Latha, R. & Sarkar, G., 2012. Detection of methicillin resistance in Staphylococcusaureus by polymerase chain reaction and conventional methods: a comparative study. Journal of Laboratory Physicians, 4(2), pp.83-88.  |
| 2. | Pournajaf,A., Ardebili,a., Goudarzi, L., Khodabandeh,M., Narimani,T., Abbaszadeh,H. PCR based identification of Methicillin resistant Staphylococcus aureus (MRSA) strains and their antibiotic research profiles. Asian Pac J Biomed 2014; 4(Suppl 1): S293-S297 |
| 3. | Khan AK,Khan, Shetty, P., Sarayu,L., Chidambaram, A., Ranganathan, R., Detection of mecA genes of Methicillin resistant stapyhlococcus aureus by polymerase chain reaction. Internation journal of health and rehabilitation sciences, 1(2),pp.64-68. |
| 4. | Clinical and laboratory Standard Institute. Performance Standards forAntimicrobial Susceptibility Testing, 2014. Approved standard, Wayne, PA:CLSI. Document M100-S24. |
| 5. | Reischl U, Linde HJ, Metz M, Leppmeier B, Lehn N (2000).Rapid identification of methicillin resistant Staphylococcus aureus and simultaneous species confirmation using real-time fluorescence PCR.J. Clin. Microbiol.,38: 2429-243 |
| 6. | Siripornmongcolchai,T., Chomvarin,C., Chaicumpar,K., Limpaiboon, T., Wongkhum,C. Evaluation of different primers for detecting mecA gene by Polymerase Chain Reaction in comparison with phenotypic methods for discrimination of Methicillin Resistant Staphylococcus aureus. Southeast Asian J Trop Med Public Health, 33(4):Dec 2002 |
| 7. | Payasi, A. & Chaudhary, M., 2013. Prevalence of heterogeneous glycopeptides intermediate resistance in Methicillin resistant Staphylococcus aureus. American journal of Infectious Diseases, 9(3), pp.63-70. |
| 8. | Kreienbuehl, L., Charbonney, E. & Eggimann, P., 2011. Community acquired necrotizing pneumonia due to methicillin sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports. AnnIntensive Care, 1(52). |
| 9. | Perichon, B. & Courvalin, P., 2009. Vana-Type Vancomycin -Resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 53(11), pp.4580-4587 |
| 10. | Betty,F., Daniel, S., Alice, W.,Bailey & Scott’s Diagnostic Microbiology.12th ed. Mosby,Elsevier2007. |
| 11. | Adaleti, R.,Nakipoglu, Y., Karahan, ZC., Tasdemir, C., Kaya, F., 2008. Comparison of polymerase chain reaction and conventional methods in detecting methicillin resistant Staphylococcus aureus. J Infect Dev Ctries, 2(1), pp.46-50. |
| 12. | Shrestha, B., Pokharel, B. & Mohapatra, T., 2009. Study of nosocomial isolates of Staphylococcus aureus with special reference to methicillin resistant S. aureus in a tertiary care hospital in Nepal. Nepal Medical College Journal, 11(2), pp.123-126. |
| 13. | Uzun, B.,Karatas, S., Gungor, S., Afsar, I., Yuksel, O., Demirci, M et al., 2013. Comparison of Cefoxitin Disk Diffusion Test, Automated System and Chromogenic Medium for Detection of Methicillin Resistance in Staphylococcus aureus Isolates. Bulletin of Microbiology, 47(1), pp.11-18. |
| 14. | Cekovska, Z., Panovski, N. & Petrovska, M., 2005. Methicillin- resistant Staphylococcus aureus Comparison of susceptibility test methods with mecA gene analysis for determining oxacillin(Methicillin) resistance in our clinical isolates. Bratisl Lek Listy, 106(4-5), pp.163-167. |
| 15. | Pourmand, MR., Hassanzadeh,S., Mashhadi,R., Askari, E., 2014. Comaprison of four diagnostic methods for detection of Methicillin resistant Staphylococcus aureus. Iran J Microbiol, October(2014); 6(5): 341-344 |
| 16. | Patil, N.R. & Ghorpade, M., 2016. Comparison of conventional phenotypic methods for detection of Methicillin Resistant Staphylococcus aureus(MRSA). International Journal of Research and Development inPharmacy and Life Sciences, 5(2), pp.20392044. |
| 17. | Panda,RK., Mahapatra,A., Mallick,B., Chayani,N. Evaluation of genotypic and phenotypic methods for detection of Methicillin resistant Staphylococcus aureus in a tertiary care hospital of eastern Odisha. Journal of Clinical and Diagnostic Research,2016 Feb,Vol- 10(2):DC 19-DC21 |
| 18. | Datta, P.,Gulati, Neelam.,Singla, Nidhi.,Vasdeva, Hena Rani.,Gupta, Kiran Bala.,Chander, Jagdish.,Varsha et al., 2011. Evaluation of various methods for the detection of meticillin-resistant Staphylococcus aureus strains and susceptibility patterns. Journal of Medical Microbiology, 60, pp.1613-1616. |
| 19. | Baral, R., Khanal, B. & Acharya, A., 2011. Antimicrobial susceptibility patterns of clinical isolates of Staphylococcus aureus in Eastern Nepal. HealthRenaissance, 9(2), pp.78-82. |
| 20. | Kumari, N., Mohapatra, T. & Singh, Y., 2008. Prevalence of Methicillin Resistant Staphylococcus aureus(MRSA) in a Tertiary Care Hospital in Eastern Nepal. J Nepal Medical Association, 47(170), pp.53-56. |
| 21. | Sanjana, R., Shah, R., Chaudhary, N., Singh,Y et al., 2010. Prevalence and antimicrobial susceptibility pattern of Methicillin Resistant Staphylococcus aureus(MRSA) in CMS- teaching hospital: a preliminary report. Journal ofCollege of Medical sciences-Nepal, 6(1), pp.1-6. |
| 22. | Khan, AU., Sultan, A., Tyagi, A., Zahoor, S., et al., 2007. Amplification of mecA gene in multidrug resistant Staphylococcus aureus strain from hospital personnel. J Infect Dev Ctries, 2007. Dec1;1(3):289-95 |
| 23. | Anupurba.,Sen, MR., Nath, G., Sharma, BM., Gulati, AK., Mohapatra, TM ., 2003. Prevalence of Methicillin Resistant Staphylococcus aureus in a tertiary referral hospital in eastern Uttar Pradesh. Indian J Medical Microbiology, 21(1), pp.49-51. |
| 24. | Farzana, K. & Hameed, A., 2006. Resistance Patterns of clinical isolates of staphylococcus aureus against 7 group of antibiotics. J Research science, 11, pp.19-28. |
| 25. | Maor, Y., Rahav, G., Belausav, N., David B, D., Mollan, G., Keller, N., 2007. Prevalence and characteristics of heteroresistant vancomycin intermediate Staphylococcus aureus bacteremia in a tertiary care centre. J ClinicMicrobiology, 45(5), pp.1151-1514. |
| 26. | Orrett, A. & Land, M., 2006. Methicillin Resistant staphylococcus aureus prevalence: current susceptibility patterns in Trinidad. BMC Infect Dis, 6(8). |
| 27. | Wadsworth, J., Satischandran, V., Axel,P., B, Suh et al., 1992. Development of New Antibiotic Resistance in Methicillin Resistant but no Methicillin Susceptibility Staphylococcus aureus. J Antimicrobial Chemotherapy, 30, pp.821-826. |
| 28. | Hiramatsu, K.,Hanaki, H., Ino, T., Yabuta, K., Oguri,T., Tenover, F., 1997. Methicillin Resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J Antimicrob Chemother, 40(1), pp.135-136 |
| 29. | Trakulosomboon, S., Danchaivijitr,S., Rongrungruang, Y., Dhireputra, C., Susaemgrat, W.,Ito,T., Hiramatsu, K et al., 2002. First report of Methicillin Resistant Staphylococcus aureus with reduced susceptibility to Vancomycin in Thailand. J Clinic Microbiology, 39(2), pp.591-595. |
| 30. | Matos, P., Schuenck, R., Cavalcante, F., Caboclo, R., Santos, K., 2010. Accuracy of phenotypic methicillin susceptibility methods in the detection of Staphylococcus aureus isolates carrying different SCC mec types. Mem. Inst.Oswaldo. Cruz, 105, pp.931-934. |
| 31. | John, M., Burden, J., Stuart, J., Reyes, R., Lannigan, R., Milburn, S., Diagre, D.,Wilson, Hussain, Z ., 2009. Comparison of three phenotypic techniques for detection of methicillin resistance in Staphylococcus spp. reveals a species dependent performance. J. Antimicrob. Chemother., 63, pp.493-496 |
| 32. | Jeljaszewicz, J., Mlynarczyk, A. & Mlynarczyk, G., 2000. Exoproteins in Staphylococcus aureus virulence. Bull Pol Ac Sci, 48, pp.77-98. |
[Figure 1], [Figure 2]
[Table 1], [Table 2]
|
Search Pubmed for